The Iraqi Journal of Veterinary Medicine

A total of 200 samples were collected from 100 goats from more than one regions within the three ‎governorates (Sulaimani, Erbil and Duhok); all these samples were tested by California mastitis test ‎and these showed the following results: 103 samples (51.50%) were negative in all governorates, ‎‎28(14.00%) were trace, 35(17.50%) were (+) mark and 34(17.00%) were (++) mark. Clinical mastitis ‎was observed on 93 out of 200 half udder of goats, in the three governorates; 37(18.5%) were acute ‎mastitis, 27(13.5%) were sub acute mastitis and 19(9.5%) were Chronic mastitis. Examination of ‎extracted DNA by Real Time Polymerase Chain Reaction out of 200 DNA extracted from milk ‎samples of goats only 10 (5.00%) were positive for Mycoplasma agalactiae in the three ‎governorates, 8(80%) from mastatic milk samples and 2 (20%) from non mastatic milk samples in ‎result of M. agalactiae. For Mycoplasma capricolum 6 (3.00%) were positive and all were from ‎mastatic milk.‎

The purpose of the present study is to determine and compare the anticoagulants, Ethylene diamine ‎tetra acetic acid, Sodium oxalate, Sodium citrate and heparin in blood samples of horse and bull, ‎through estimation of (Hemoglobin, Packed Cell Volume and Plasma Platelets Count) and plasma ‎physical properties (clarity and volume) and some chemical properties (pH and calcium ion ‎concentration). Five Blood samples were obtained from five stallions and five bulls (20 ml/sample) ‎and were divided as 5 ml in four test tubes containing Ethylene diamine tetra acetic acid, sodium ‎oxalate, sodium citrate and heparin at the College of Veterinary Medicine, University of Diyala. ‎Hemoglobin and packed cell volume were estimated immediately and then the blood samples were ‎centrifuged for 15 min. at 3000 rpm to obtain plasma for evaluating the physical and chemical ‎properties specified above. The horse blood samples pertaining data had no significant elevation in ‎hemoglobin concentration and packed cell volume in Ethylene diamine tetra acetic acid group as ‎compared to other groups, beside having no significant changes in pH between the four treated ‎groups while there was a significant increase in plasma volume of oxalate and citrate as compared to ‎Ethylene diamine tetra acetic acid and heparin, and there was a significant increase in plasma ‎platelet count of Ethylene diamine tetra acetic acid group as compared to heparin. As well there was ‎a significant decrease of calcium ion concentration in Ethylene diamine tetra acetic acid, oxalate and ‎citrate as compared to heparin, while the results of bull blood samples revealed that the hemoglobin ‎and Packed Cell Volume were significantly higher in heparin group than in the oxalate and citrate ‎groups with non significant differences with Ethylene diamine tetra acetic acid group. The plasma ‎obtained from different types of anticoagulants appeared with a high degree of clarity, and the ‎volume of plasma had no significant increase in oxalate and citrate group as compared to other ‎groups. The Plasma Platelet Count and calcium concentration significantly increased in heparin ‎group as compared to other groups. In conclusion, the Ethylene diamine tetra acetic acid was more ‎reliable for horse blood samples while the anticoagulant heparin was more reliable anticoagulant for ‎bull blood samples.‎

Anatomical and histological explorations of the tongue in ten adult male Porcupine (Hystrix cristata) ‎collected from AL-Diwanyha city by the hunter, after porcupine prepared the tongue illustrious ‎after that the position, shape dimensions were enrolled. The square-shape of body, thicken less ‎steadily toward caudal part of tongue. Root was tends caudally in the direction of the epiglottis. ‎Torus linguae found on the caudal part of the dorsal surface of the tongue. In the end of lateral ‎surface of tongue have foliate papilla osculate the premolar teeth. The length, apex, body and root ‎of the tongue were (7.6±0.66, 1.25±0.23, 4.95±0.2, and 1.4±0.26 cm), respectively. The width, ‎apex, body, and root of the tongue were (1.80±0.77, 0.35±0.49, 1±0.22 and 0.45±0.14, respectively. ‎In the dorsal and lateral surface have muscle fibers from skeletal type and loose connective tissue ‎bounded by keratinized stratified squamous epithelium while in the ventral lingual surface were ‎non-keratinized. In the dorsal surface of body there were filiform papillae, but less at the lateral ‎surface of the body. While the shape of circumvallate papillae was similar to furrow, and there was ‎taste buds on the both dorsal and lateral sides of the tongue. Fungiform papillae had wide curved ‎keratinized surface, with taste buds on the dorsal surface. Lamina propria and submucosa was loose ‎connective tissue with more of collagen fiber. ‎

‎ This research aims to prepare ZnO NPs by using chemical bath deposition way from ZnSO4 and ‎NaOH as starting materials. It was examined by X-ray diffraction, Scanning Electron Microscopy, ‎Zeta potential and Fourier Transformation Infrared. Scanning Electron Microscopy images showed ‎various morphological changes of ZnO nanoparticles obtained by the above method and the ‎different magnification Scanning Electron Microscopy images of the nanoparticle and confirms that ‎the Nano flowers are grown with well-defined morphology and diameters varying between 60-110 ‎nm. The effect of Zinc oxide nanoparticles against bacteria staphylococcus aureus, E.coli and ‎Pseudomous aeruginosa showed the ability of this substance to inhibit the growth of all types of ‎bacteria in different concentrations. The percentage of survival bacteria was (2, 3.7 and 6%) for ‎E.coli bacteria and (1, 1.5 and 5 %) for Pseudomous aeruginosa bacteria, while the percentage was ‎‎(0.8, 1 and 1.5 %) for staphylococcus aurous respectively for all concentration.‎

‎ Three hundred samples of stool were collected from children, who are suffering from diarrhea, ‎during the period from October to December 2016 at Fatima Al Zahra and Shaheed al-Sadr ‎hospitals. All bacterial isolates have been submitted to the cultural, microscopical, biochemical ‎examinations, and Vitek 2 system identification to identify Aeromonas isolates. All the isolates ‎under study were tested for their ability to the production of certain factors associated with ‎virulence. It has been concluded that 12 (4%) of collected samples were positive to Aeromonas Spp. ‎The virulence factors of Aeromonas spp. were detected and showed that all the isolates have the ‎ability to produce haemolysin, protease, lipase, phospholipase, gelatinase enzymes, and biofilm on ‎Congo red agar. ‎

Antigens prepared from sonicated Salmonella typhimurium (KWCSA-ST) and Lactobacillus ‎acidophilus (KWCSA-LBA) were used to evaluate synergistic effect on interlukine production (IL-‎‎2, IL-4) and Immunoglobulin-G (IgG) which were evaluated by using Enzyme Linked ‎Immunosorbent Assay and Delayed Type Hypersensitivity-skin test at day 20 post immunization. ‎Twenty five rabbits of both sexes, 2-3 Kg body weight, were divided into five equal groups; the ‎first group immunized by KWCSA-ST (1000 µg/ml) and KWCSA-LBA (1000 µg/ml), the second ‎group by KWCSA-ST (1000 µg/ml) and KWCSA-LBA (500 µg/ml), the third group by KWCSA-‎ST (1000 µg/ml) as positive control, the fourth group by KWCSA-LBA (1000 µg/ml) as positive ‎control and the fifth group was injected by P.B.S. (pH7.2) as negative control group ‎subcutaneously. The result of delayed type hypersensitivity showed an increase in the means of ‎erythema and induration in the 1st group after 24hrs and 48hrs while the 4th group recorded the ‎lowest mean after 24hrs and 48hrs. These means showed significant differences (P˂0.05) ‎compared with injection by 1:2 and 1:4 diluted Ag. While the results of IgG showed that the ‎highest concentration was at 35th day in the first group while the lowest concentration at 35th day in ‎the fourth group with significant differences (P<0.05). Also the high concentration of IL-2, IL-4 ‎was recorded in the first group at 35th day and the lowest concentration was in the fourth group at ‎‎35th day with significant differences (P<0.05); also the results showed significant differences ‎‎(P<0.05) between the 1st, 2nd, 3rd compared with 4th and 5th groups.‎

Summary
‎ Yersiniosis is a zoonotic disease which infects many animal species. A preliminary study was ‎done to detect the incidence of Yersinia enterocolitica in sheep. One thousand and two hundred ‎fecal samples were collected randomly from sheep in four governorates in the southern region of ‎Iraq: Thi-Qar, Al-Muthana, Messan and Basrah, in the period from July 2016 to June-2017. ‎Enrichment Yersinia broth at 4°C for 48 hours was used for isolation of Yersinia enterocolitica. ‎Selective Cefsulodin Irgasan Novobiocin and non selective media were used for bacterial culture. ‎The identification of Yersinia enterocolitica was based on colony morphology and biochemical ‎characters, API 20E and VITEK2 compact systems were used for the same purpose also. Data were ‎analyzed by using SAS, Version 9-1. Chi- square test was used for comparison. The total isolation ‎rate of Y. enterocolitica was 5.16% (62). High and low rates of isolation were recorded in Al-‎Muthana (6. 01%) and Basrah (3.86%). Similarly a significant high isolation rate was recorded in ‎diarrheic sheep (17.4%), moreover the infection rate increased significantly (9.5%) in the young ‎sheep (1day to 6 month's age). Furthermore, the recovery rate of Y. enterocolitica increased ‎significantly during the cold months (12%) as compared with temperate and hot months (spring and ‎summer), at the same instance, non significant variation among sex difference was detected. Fever, ‎diarrhea and mild to moderate degree of dehydration were the most common clinical manifestations ‎observed on the infected animals. Conclusively sheep were considered a source of infection to other ‎species including human being, and the spread of microorganism increased markedly in the cold and ‎wet environment.‎

‎ One hundred and fifty stool sampling were collected from clinical sources‏ ‏responsible of causing ‎diarrhea in adults as well as children. The identification of Aeromonas hydrophila isolates depended ‎on common methods of identification dependent on biochemical characteristics and culture, then ‎vitek2 compact system was used. Eight Aeromonas hydrophila isolates were gained and revealed ‎various productivity of metalloprotease; the isolate number 8 was the maximum effective in ‎metalloprotease production. The eight isolates were examined with Polymerase Chain Reaction to ‎prove enzyme gene presence, the results revealed that all isolates were positive for ahMP genes; ‎metalloprotease was completely purified via a number of steps, which included ammonium sulphate ‎precipitation, dialysis, ion exchange and gel chromatography. Cytotoxicity effect of metalloprotease ‎studies on cancer and normal cell lines, The results showed the purified metalloprotease as effective ‎cytotoxic effect on liver hepatocellular cancer cells (HepG2) compared with no effect on normal ‎liver cell line (WRL-68) indicating less cytotoxic effect.‎

‎ Velogenic Newcastle Disease Virus was isolated from broiler chickens in Northern Iraq. An ‎inactivated vaccine was manufactured locally using as seed virus ELD50/ml109 and then compared ‎with commercial inactivated vaccine in an experimental study which included 120 broiler chicks ‎divided into three groups (G1 unvaccinated control, G2 for commercial vaccine and G3 for local ‎vaccine). The chicks were injected subcutaneously at 3 days old followed by booster Lasota live ‎vaccine eye drop.‎‏ ‏Indirect ELISA technique was used to estimate the antibody titer from the ‎collected sera of chicks at age 7, 17 and 27 days (pre-challenge) and challenged at 31 days old with ‎the same virus. The results indicated that there were significant differences (P<0.05) between ‎vaccinated group G2 and G3 at 27th day old and showed a high antibody level with high protection ‎percentage compared with the control. G1 which shown no survival, 100% mortality and severe ‎histopathological lesions, while in G2 and G3 was 43% and 87% respectively. Post-challenge ‎antibody titers of survival chicks showed in G3 significantly over the G2 with less severe ‎histopathological lesions. This study concluded that vaccine failure could occur due to factors of the ‎immune status of the host, improper storage of vaccine, improper vaccination and variant pathogenic ‎virus strain. More epidemiological surveillances are required to decide the actual impact of the ‎disease in poultry farms and matching the vaccines.‎

‎ This review was made to explore the recent multiple studies on enzootic bovine leukosis, focusing ‎on its prevalence, economic impact, the link with public health and the possibility to cause cancer in ‎humans. The causative agent of enzootic bovine leukosis is a virus closely related to human T- cell ‎leukemia virus (HTLV-1). The closeness between the two viruses helps the progress of cancer ‎research in diagnosis and treatment, also the development of a vaccine in both human and veterinary ‎medicine .The enzootic bovine leukosis is widely spread in the continents. The economic loses of ‎enzootic bovine leukosis is related to the lowered productivity of effected cattle, morbidity, ‎mortality and cost of control and eradication. This review proved that bovine leukemia virus is ‎innocent from human cancer infection and there is no proof of virus living in human tissues. But this ‎subject needs a lot of research to know the mechanism of the virus and its affects in cellular content ‎of the organism. ‎

The study was designed to determine the abnormal urine components such as red blood corpuscles, ‎protein, bilirubin, nitrites, specific gravity, glucose, hydrogen ion, ketones, urobilinogen and ‎leukocyte abnormality in k9‎‏ ‏dogs urine‏.‏The present study was carried out on 135 asymptomatic ‎dogs (65 males and 70 females) with age (2 – 8 years) in Al-Najaf governorate between February ‎‎2016 and April 2016. At morning, urine specimens were collected from dogs and tested via method ‎of dipstick. Mass urinary screening is a suitable tool to detect dogs with asymptomatic progressive ‎renal diseases, however the urinalysis can deliver to us information not merely about the kidneys ‎and bladder, but also the liver, pancreas, and other organs, as well as, helping to make a diagnosis, in ‎addition to determining a prognosis (a prediction of the consequence of the disease) and response to ‎treatment. Results showed that 46 (34%) dogs were with urinary abnormalities, hematuria was the ‎most frequent abnormality showed 28(60.9%), nitrituria 10(21.7‎‏%‏‎), proteinuria 4(8.7‎‏%‏‎), ‎bilirubinuria in 2(4.3%) and decreased specific gravity 2(4.3%) respectively, pH (0%), glucose (0%), ‎ketones (0%), urobilinogen (0%) and leukocyte (0%). ‎

The aim of the current study was to compare the efficacy of Kessler suture pattern and ‎polypropylene meshes implantation to repair severed Achilles tendons in bucks. For this purpos 16 ‎local adult bucks, weighing 30-35kg were used and equally distributed into two groups, the first ‎group: (control group) and the second group (mesh group). Animals were sedated with xylazine 2% ‎and anesthetized locally with lidocaine hydrochloride 2% infiltrated subcutaneously. Skin incision ‎approximately 5 cm. in length was made over the Achilles tendon. The tendon was isolated by blunt ‎dissection from the underlying tissue, then the left Achilles tendon was transected in its mid ‎portion. In the control group, tenorrhaphy of Achilles tendons were immediately performed by using ‎Kessler suture technique using (polypropylene No. 1). In the second group, a polypropylene mesh ‎was wrapped around the cut ends and fixed to the tendon by simple interrupted stitches of ‎polypropylene thread (No.1). Then skin was sutured by interrupted horizontal mattress using silk ‎No.1. Finally plaster of Paris with window was applied. The skin stitches were removed after 10 ‎days. The clinical signs of all animals showed severe lameness during the first three weeks with no ‎significant differences between the two groups. Lameness reflected significant differences (P<0.05) ‎between groups with the progress of postoperative duration (i.e., starting from 4th week). Rapid ‎absence of lameness was more observed in second group (at 4th week) than in first group (at 6th ‎week). At two months post-operative, a higher percentage (100%) was recorded in first group. ‎While a lower percentage (25%) was showed in the second group. Microscopical examination at two ‎month post-suturing revealed proliferation of fibrous connective tissue around suture materials ‎infiltrated by inflammatory cells, in addition to necrotic tissue attachment to the tendon. In mesh ‎implantation and at the same time there were granulations tissues surrounding the narrow mesh holes ‎with tendon fibers expressed proliferation of tenocytes. At four months, first group revealed few ‎blood vessels, and thickened collagen fibers with mononuclear cells infiltration in cut tendon fibers. ‎In mesh implantation the tendon was retained to its nearly normal structure with few (MNCs) in ‎epitenon. It seemed that both groups gave best outcome in healing of operated tendons with ‎superiority of the second group in comparison with the first group. ‎

‎ Equine herpsvirus type1 was classified as a member of the subfamily Alphaherpesvirinae. It was ‎reported to cause respiratory, reproductive and neurologic infection in horses. The reproductive form ‎of the disease induces abortion in pregnant mare, while the neurologic form is associated with ‎paralysis of infected horses. This study was designed for molecular detection of Equine herpsvirus ‎type1 by polymerase chain reaction. Blood buffy coat samples were collected from 25 horses (Equus ‎feruscaballus) and 25 donkeys (Equus asinus) admitted to local private veterinary clinics around ‎Baghdad and Baaquba cities. DNA was extracted from such samples by the use of DNA extraction ‎kit of COLLECTAGENET .The samples were subjected to conventional PCR test using specific ‎primers for gB gene of equine herepesvirus-1. Forward primer (F) (5’ TAACTGAGATCT ‎AACCGAC 3’) and reverse primer (R) (CATATATAGCTATCACGTCC 3’). One buffy coat ‎sample from aborted mare and one buffy coat sample from a donkey suffering from acute ‎respiratory clinical signs were inoculated in mice to follow the fate of equine herepesvirus-1in nasal ‎turbinates, cervical lymph nodes and lungs of these mice. The results showed that only 4 samples ‎from horses and 2 samples from donkeys were positive to polymerase chain reaction. Experimentally ‎infected mice did not show any clinical signs but they were positive to polymerase chain reaction, ‎and the virus easily terminated, probably due to low dose of the virus and host specificity. It can be ‎concluded that local horses and donkeys, somewhere have had infected with equine herepesvirus-1, ‎and became latent carriers for the virus. Furthermore, microbiological and epidemiological studies on ‎local Equine herpsvirus type1 and Equine herpsvirus type 4 are recommended.‎

The main objectives of this study is the separation of X from Y bearing epididymal spermatozoa of ‎local buck by swim-up, and the use of this spermatozoa for in vitro fertilization to determine the ‎percentage of produced male and female embryos. The sex of produced embryo was identified by ‎polymerase chain reaction. Testis of the local buck were obtained from Al-Shu'alah abattoir and the ‎epididymal spermatozoa were harvested from the cauda by and submitted to in vitro maturation ‎prior to separation of X from Y bearing spermatozoa and prior to their use for in vitro fertilization. ‎For the separation of epididymal spermatozoa, swim-up technique was used with centrifugation at ‎‎200×g or 300×g. The centrifugation at 200×g showed that 41.84±1.39 % of spermatozoa were ‎detected in the supernatant while the precipitate contained 50.69±0.71 and the mean of the sperm ‎lost was 7.65±0.93. After centrifugation, spermatozoa in the supernatant were used for in vitro ‎fertilization of matured oocytes. The sex of in vitro produced goat embryos was determined by ‎polymerase chain reaction using specific primers to detect of SRY gene. The percentage of total ‎goat embryos obtained after in vitro fertilization by sperms selected using swim-up at centrifugation ‎force of 200×g recorded 79.66 % male embryos while female embryos recorded only 20.33 %. At ‎the end, the results showed the ability of selection male embryos in caprine by application of swim-‎up technique on epididymal spermatozoa with centrifugation at 200×g. ‎

‎ In this investigation the common carp, Cyprinus carpio L. 1758 was exposed to contaminated ‎feed with Aspergillus flavus under laboratory aquarium conditions (glass ponds) for 90 days. Results ‎revealed that the contaminated feed with (A. flavus) has significantly affect in body weight change, ‎blood and biochemical parameters of groups fed on contaminated feed with A. flavus. Body weight ‎changes were decreased in group feeding on contaminated feed with A. flavus in comparison with ‎control group. The results showed decreases in RBCs, PCV% and Hb concentration but WBCs was ‎increased in treatment fish in comparison with the control group. In addition, serum Glutamic ‎pyruvic trans-aminase, Glutamic oxaloacetic trans-aminase and total cholesterol as compared to ‎control showed an increase (P<0.05) in these parameters in contaminated fish but total protein was ‎decreased in same groups. In conclusion, A. flavus is produced toxic compounds that represent a ‎serious source of contamination in foods; this confirms the infection of aquacultures’ fishes with A. ‎flavus. So, one should not store foods for long periods or under poor conditions, fish health ‎problems may arise.‎

‎ The objective of this study was to evaluate the usefulness of ultrasound in the examination of ‎urinary system in buffaloes. Ultrasonography of the urinary system was done for 60 local buffaloes ‎breed, 1-15 years old of both sexes in Mosul/Iraq, and they then were divided into two groups ‎according to age, 25 calves less than 2 years and 35 adults 2-15 years. Kidney measurements are ‎taken from three different sites (right lumbar, right sublumbar and right twelfth intercostal space. ‎The right sublumbar region is the best area for getting good ultrasonographic images (in both adult ‎and calves) followed by right lumbar region which gives clear images in adult buffaloes. ‎Ultrasonographic examination for the left and right kidneys in adult buffalo and their calves showed ‎no significant difference in kidney measurements from different sites (lumbar, sublumbar, twelve ‎intercostal space). The results showed that the mean thickness of right kidney of buffaloes aged 2-‎‎15 years from right sublumbar region was (7.40±0.13) centimeters and in buffalo calves was ‎‎(5.29±0.23) cm. The mean thickness of left kidney of buffaloes from right sublumbar region was ‎‎(7.30±0.20) cm, and in buffalo calves was (5.06±0.59) cm. The urinary bladder is easily observed by ‎ultrasonography per-rectum in adult and percutaneous in calves (right sublumbar region). The urinary ‎bladder appears as circumscribed round to oval structure in the pelvic area. It usually contains ‎anechoic to hypoechoic urine. The wall of urinary bladder is echogenic, smooth and its thickness ‎varies with the amount of bladder distention. Positive correlation between right kidney thickness ‎‎(cm) (from right sublumbar region) and the age (months) for buffaloes (0.627).‎

Chlamydiasis during pregnancy should be considered a significant risk factor for adverse pregnancy ‎outcomes in humans. 120 women who had a single or repeated abortion were selected for this study, ‎and they were referred with a physician report for TORCH tests to determine the final diagnosis of ‎pregnancy loss. The control were (40) healthy pregnant women with a history of a normal ‎pregnancy. The innate immunity in abortive women was higher than normal pregnancies, that was ‎estimated by Nitroblue Tetrazolium test done to estimate the phagocytic activity, there was a ‎significant increase (P=0.009) in phagocytic activity in the leukocytes of abortive women which was ‎‎(22%) higher than that in control. Also, the cellular immune response was higher in abortive women ‎than that in control. Methyl Thiazolyl Tetrazolium assay was performed to estimate lymphocyte ‎transformation index of peripheral blood leukocytes in abortive women. The results of Methyl ‎Thiazolyl Tetrazolium assay showed a significant increase (P=0.001) in the lymphocyte ‎transformation index in the lymphocytes of abortive women which was (27%) higher than control. ‎The serological detection by ELISA showed that anti-C. trachomatis IgG was (14.2%), and the ‎molecular detection by Quantitive Real Time-Polymerase Chain Reaction showed positive results ‎‎(17.5%) of total abortive women. The present study demonstrated a high level of relationship ‎between C. trachomatis and abortion among women in the study samples. The age group (20-‎‎25years) was the most susceptible to chlamydial infection and the infection was higher in recurrent ‎miscarriages than in single miscarriage.‎

The study achieved isolating Campylobacter spp from diarrheic and non-diarrheic cows and studying the percentage of diarrhea in 10 areas in Baghdad governorate (AL Shaeluh, Abou Ghurayb , Khadmyia , Sadar city , Suwyria, Mahmudyia, Latifyia , Alridwaniuh, Hur Rajb and Yousfyia), One thousand fecal samples were cultured on different selective culture media specific for Campylobacter spp ,and different biochemical tests were used (oxidase reaction, Oxoid biochemical identification system campy, Tripple Sugar Iron ( TSI) , hippurate hydrolysis and the use of Vietik (NH). Eighty isolates of Campylobacter spp were recorded ( 8% ).Campylobacter spp isolates included C. jejuni 30(3%) C. coli 30(3%) and C.lari 20(2%). High percentage of diarrhea was recorded in Hur rajb and Abou Ghurayb 70(82.35%) , 81 (81.81 %) respectively while lower percentage of diarrhea was in Mahmudyia and Yousfyia in percentage 43(39.09%).50(46.72%), High percentage of campylobacter isolates was recorded in AL shaeluh 15 (18.75%) , while lower percentage of isolates was recorded in Hur rajb and Yousfyia 5(6.25%), 4(5%) respectively . Age group one day to one month gave the highest isolation rate 50 %(40) while lowest isolation rate in age group(6 months to 1year) 5% ( 4) under (P ˂0.0001) level. The highest isolation rates were recorded in Summer 2016(19.16%) and Summer 2017 (24.32%) while the lowest isolation rates was recorded in Winter (0.8%). Animals infected with C. jejuni and C coli , showed obvious clinical signs including depression, loss of appetite and inability to feed newborn calves, they suffered from severe diarrhea and dehydration, and the presence of blood and thick mucus , high fever were observed in some animals, while in animals infected with C.lari the clinical signs, were mostly within normal limits .It can be concluded that two species of campylobacter( C.coli and.C. Lari) isolated from diarriheic cows,are new species added to the two species of campylobacter (C. fetus and C.Jejuni) previously isolated from cows in Iraq and increasing the total campylobacter species confirmed in Iraq to four spp.